Sequence ID | >WENV180094751 |
Genome ID | MTBK01028195 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 22943 |
End posion on genome | 22871 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctttgttttt |
tRNA gene sequence |
GCCGCTATGGCTCAATGGTAGAGCAACGCACTTGTAATGCGTAGGTTGTTGGTTCGATTC |
Downstream region at tRNA end position |
aaaatgttct |
Secondary structure (Cloverleaf model) | >WENV180094751 Thr TGT t TCaa aaaatgttct G - C C - G C - G G - C C - G T - A A - T T T T C A G C C A A A G | | + | | G T C T C G G T T G G C G | | | | T T G G A G C T A A AGGTT A - T C - G G - C C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |