Sequence ID | >WENV180094755 |
Genome ID | MTBK01028338 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 5200 |
End posion on genome | 5116 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acgtttttgg |
tRNA gene sequence |
GCGAGGGTAGCCAAGCCCGGCCAAAGGCGGTGGACTTAAGATCCACTCCCGCAGGGGTCC |
Downstream region at tRNA end position |
tgacttcagg |
Secondary structure (Cloverleaf model) | >WENV180094755 Leu TAA g Atcc tgacttcagg G - C C - G G - C A - T G - C G - C G - C T A T T A C C C A C C G A A + | | | | G C A C C G G T G G G C G | | | T T G A G G C C C A A G TCCCGCAGGGGTCC G - C T - A G - C G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |