Sequence ID | >WENV180094756 |
Genome ID | MTBK01028461 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 133 |
End posion on genome | 41 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gccttttttt |
tRNA gene sequence |
GGAGGGTTGTCCGAGCTGGCTGAAGGAGCGCGACTGGAAATCGCGTGTACCCGTAAAAGG |
Downstream region at tRNA end position |
aaaaaaggga |
Secondary structure (Cloverleaf model) | >WENV180094756 Ser GGA t GCCA aaaaaaggga G - C G - C A - T G - C G - C G - C T + G T A T T T C T C A T C G A G + | | | | G G G C C T G A G A G C G | | | T T C A G G A T G A G TGTACCCGTAAAAGGGTATC C - G G - C C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |