Sequence ID | >WENV180094758 |
Genome ID | MTBK01028548 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 305 |
End posion on genome | 396 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tattagcgcc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTCCGGTTGATTGCGCCGCACTCGAAATGCGGTGTCCGCCTGCTGG |
Downstream region at tRNA end position |
gaaagcctaa |
Secondary structure (Cloverleaf model) | >WENV180094758 Ser CGA c GCtg gaaagcctaa G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A C T G A G | | | | | G C G A C G G G G G G C G + | | | T T G T T G C T T G A G TGTCCGCCTGCTGGCGGACC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |