Sequence ID | >WENV180094786 |
Genome ID | MTBK01030564 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1407 |
End posion on genome | 1478 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caaggtacaa |
tRNA gene sequence |
GGTTCCTTGGCCGAGTGGTTAGGTAGCGGTCTGCAAAACCGCCTACGGCGGTTCGATTCC |
Downstream region at tRNA end position |
acttttacaa |
Secondary structure (Cloverleaf model) | >WENV180094786 Cys GCA a TCag acttttacaa G - C G - C T - A T - A C - G C - G T - A T T T C C G C C A G A G | | | | | G T G C C G G G C G G C G | | + T T G A G G T T T A CTAC G - C C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |