Sequence ID | >WENV180094790 |
Genome ID | MTBK01030856 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3645 |
End posion on genome | 3559 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cccgccggcc |
tRNA gene sequence |
GCGAAAGTGGCGGAATTGGTAGACGCGCAAGCCTCAGGAGCTTGTGGTCGCAAGGCCGTG |
Downstream region at tRNA end position |
gcctcctccc |
Secondary structure (Cloverleaf model) | >WENV180094790 Leu CAG c ACCA gcctcctccc G - C C - G G - C A - T A - T A - T G - C T G T C C C C C A T A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TGGTCGCAAGGCCGT C - G A - T A - T G - C C - G C A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |