Sequence ID | >WENV180094801 |
Genome ID | MTBK01031274 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 18361 |
End posion on genome | 18434 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtcatgacat |
tRNA gene sequence |
TGCCGATTAGTGTAACGGTAGCACACCTGACTCTGACTCAGTTTGTCCGGGTTCAAATCC |
Downstream region at tRNA end position |
aaaccccgga |
Secondary structure (Cloverleaf model) | >WENV180094801 Gln CTG t GCCA aaaccccgga T - A G - C C - G C - G G - C A - T T - A T A T G G T C C A A A A | | + | | A C T G T G C C G G G C G + | | | T T G G C A C T A A TTGT C T C - G T - A G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |