Sequence ID | >WENV180094802 |
Genome ID | MTBK01031274 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11437 |
End posion on genome | 11362 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tacaggctgc |
tRNA gene sequence |
GCCTGCGTAGCTCAGCTGGTAGAGCAGCCGCCTTGTAAGCGGCAGGTCGGGAGTTCGAAT |
Downstream region at tRNA end position |
gaaaaactcc |
Secondary structure (Cloverleaf model) | >WENV180094802 Thr TGT c TCCA gaaaaactcc G - C C - G C - G T - A G - C C - G G - C T A T C T G T C A C G A A | + | | G T C T C G G G G A G C G | | | | T T G G A G C T A A AGGTC G - C C - G C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |