Sequence ID | >WENV180094807 |
Genome ID | MTBK01031957 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 147664 |
End posion on genome | 147738 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccgacactcc |
tRNA gene sequence |
GGTCCCGTGGCTCAGTGGGAGAGCGTCCGCTTCACACGCGGAAGGTCGCTGGTTCGATCC |
Downstream region at tRNA end position |
cgtcaaaaca |
Secondary structure (Cloverleaf model) | >WENV180094807 Val CAC c ACCA cgtcaaaaca G - C G - C T - A C - G C - G C - G G - C C T T C G A C C A G A G | | | | | G T C T C G G C T G G C G | | | | T T G G A G C G A G AGGTC T - A C - G C - G G - C C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |