Sequence ID | >WENV180094824 |
Genome ID | MTBK01033132 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3203 |
End posion on genome | 3286 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ctctgctgtT |
tRNA gene sequence |
GCGCTGGTGCTGGAATTGGCAGACAGGCGTGGTTGAGGGCCACGTGCCGAAAGGCGTGAG |
Downstream region at tRNA end position |
aaacacaagc |
Secondary structure (Cloverleaf model) | >WENV180094824 Leu GAG T ATgc aaacacaagc G - C C - G G - C C - G T - A G - C G + T T T T C T C C C A T A A G | | | | | G T G G T C G A G G G C G | | | T T G A C A G C A G G TGCCGAAAGGCGT C - G G - C T - A G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |