Sequence ID | >WENV180094825 |
Genome ID | MTBK01033194 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4268 |
End posion on genome | 4195 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gaataaaatt |
tRNA gene sequence |
GGGCTTATGGTCTAGTGGTACGACACTGCATTCGCATTGCAGAGACGCGAGTTCGATTCT |
Downstream region at tRNA end position |
aatgggattt |
Secondary structure (Cloverleaf model) | >WENV180094825 Ala CGC t ACCA aatgggattt G - C G - C G + T C - G T - A T - A A - T T T T C G C T C A G A G | | | | | G T T C T G G C G A G C G | | | T T G C G A C T A A AGAC C - G T - A G - C C - G A - T T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |