Sequence ID | >WENV180094830 |
Genome ID | MTBK01033571 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 17662 |
End posion on genome | 17735 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gataaaagtt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGCAGAACATTAGCTTCCCAAGCTAAATACGGGGGTTCGATTCC |
Downstream region at tRNA end position |
gaaaccgccg |
Secondary structure (Cloverleaf model) | >WENV180094830 Gly CCC t TCCA gaaaccgccg G - C C - G G - C G - C G - C T - A G - C T T T T C C C C A A A A + | | | | G T C T T G G G G G G C G | | | | T T G G A A C C A A ATAC T - A T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |