Sequence ID | >WENV180094837 |
Genome ID | MTBK01034305 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3063 |
End posion on genome | 2968 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aagcaaatat |
tRNA gene sequence |
GGAGAGGTGGCTGAGCTTGGCTGAAGGCGCTCGATTGGAAATCGAGTAGGCGGGCTAAAA |
Downstream region at tRNA end position |
ttaaagaatt |
Secondary structure (Cloverleaf model) | >WENV180094837 Ser GGA t GCCA ttaaagaatt G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T C G A G | | | | | A T G T C G G C G G G C G + | | T T G A G G C C T G A G TAGGCGGGCTAAAACCTGCCTC C - G T - A C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |