Sequence ID | >WENV180094841 |
Genome ID | MTBK01034534 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 412 |
End posion on genome | 495 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cacttcacac |
tRNA gene sequence |
GGGGCGGTGGCGGAATAGGCAGACGCAACGGACTTAAAATCCGTCGGTGGAGACACCGTG |
Downstream region at tRNA end position |
agagctctta |
Secondary structure (Cloverleaf model) | >WENV180094841 Leu TAA c Atgt agagctctta G + T G - C G - C G - C C - G G - C G - C T G T C A C C C A T A A G | | | | | A A G G C G G T G G G C G | | | T T G A C G C C A G A CGGTGGAGACACCGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |