Sequence ID | >WENV180094877 |
Genome ID | MTBK01036647 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 19053 |
End posion on genome | 18979 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
actgcggttc |
tRNA gene sequence |
GCGGGAGTAACTCAGGGGTAGAGTCACAGCCTTCCAAGCTGTTGGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
tgccgcgcgt |
Secondary structure (Cloverleaf model) | >WENV180094877 Gly TCC c TCCA tgccgcgcgt G - C C - G G - C G - C G - C A - T G - C T A T T G C C C A G A A + | | | | G G C T C A G C G G G C G | | | | T T G G A G T T A C TGGTC A - T C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |