Sequence ID | >WENV180094878 |
Genome ID | MTBK01036647 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 18864 |
End posion on genome | 18790 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cggtcgtccc |
tRNA gene sequence |
GCCCACGTGGCTCAGGGGTAGAGCACCTCCTTGGTAAGGAGGGGGTCATCGGTTCGAATC |
Downstream region at tRNA end position |
cgagtctgac |
Secondary structure (Cloverleaf model) | >WENV180094878 Thr GGT c TCCA cgagtctgac G - C C - G C - G C - G A - T C - G G - C T A T T A G C C A G A G | | | | | G G C T C G A T C G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |