Sequence ID | >WENV180094886 |
Genome ID | MTBK01037015 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 215 |
End posion on genome | 129 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aactactcgt |
tRNA gene sequence |
GGGCGGGTGGCGGAATTGGTATACGCGCAACGTTGAGGTCGTTGTGGGGTAAAACCCGTG |
Downstream region at tRNA end position |
ataaatctgc |
Secondary structure (Cloverleaf model) | >WENV180094886 Leu GAG t ACCA ataaatctgc G - C G - C G - C C - G G - C G + T G - C T G T T G T C C A T A A G + | | | | A T G G C G G C A G G C G | | | T T G A C G C T A T G TGGGGTAAAACCCGT C - G A - T A - T C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |