Sequence ID | >WENV180094889 |
Genome ID | MTBK01037402 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 411 |
End posion on genome | 497 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aatgcaaatT |
tRNA gene sequence |
GGAAGGTTGGCAGAGTGGTTGAATGCGCACCGTTGGAAACGGTGTTTACCGCAAGGTAAC |
Downstream region at tRNA end position |
ttttttatat |
Secondary structure (Cloverleaf model) | >WENV180094889 Ser GGA T GAtt ttttttatat G - C G - C A - T A - T G - C G + T T - A T A T C C C C C A T G A G | | | | | A G G A C G G G G G G C G | | | T T T A T G C T G A G TTTACCGCAAGGTAAC C - G A - T C - G C - G G - C T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |