Sequence ID | >WENV180094898 |
Genome ID | MTBK01038262 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1809 |
End posion on genome | 1735 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caggcattga |
tRNA gene sequence |
TCCCCTGTAGCTCAATGGTAGAGCGTCCGGCTGTTAACCGGCAGGTTCGTGGTTCGAGTC |
Downstream region at tRNA end position |
agcttgacga |
Secondary structure (Cloverleaf model) | >WENV180094898 Asn GTT a GCCA agcttgacga T - A C - G C - G C - G C - G T + G G - C T G T G C A C C A A A A | | | | | G T C T C G C G T G G C G | | | | T T G G A G C T A G AGGTT T C C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |