Sequence ID | >WENV180094923 |
Genome ID | MTBK01039030 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 10711 |
End posion on genome | 10785 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccgctcggca |
tRNA gene sequence |
GGGAGGTTAGCTCAGTGGTAGAGCACCTGCCTTACACGCAGGGGGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
gggatgaccg |
Secondary structure (Cloverleaf model) | >WENV180094923 Val TAC a ACCA gggatgaccg G - C G - C G - C A - T G - C G - C T - A T A T C C C C C A G A A | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C C - G C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |