Sequence ID | >WENV180094937 |
Genome ID | MTBK01039363 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 9 |
End posion on genome | 93 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
nntaaaattt |
tRNA gene sequence |
GCCGAGGTGGCGGAATTGGCAGACGCGCTAGGCTTAGGACCTAGTCCCCTTTGGGGGTTG |
Downstream region at tRNA end position |
acgaataaaa |
Secondary structure (Cloverleaf model) | >WENV180094937 Leu TAG t ACaa acgaataaaa G - C C - G C - G G - C A - T G - C G - C T G T C T C C C A T A A G | | | | | G T G G C G G A G G G C G | | | T T G A C G C C A G G TCCCCTTTGGGGGTT C - G T - A A - T G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |