Sequence ID | >WENV180094949 |
Genome ID | MTBK01039965 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2418 |
End posion on genome | 2489 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aagttcgcat |
tRNA gene sequence |
GCGGGCGTAGCCAAGTGGTAAGGCAGTAGCTTCCCAAGCTACCATTCGTGGGTTCGAGTC |
Downstream region at tRNA end position |
caaaaatcgc |
Secondary structure (Cloverleaf model) | >WENV180094949 Gly CCC t Tttt caaaaatcgc G - C C - G G - C G - C G - C C - G G - C T G T T A C C C A G A A + | | | | G T A C C G G T G G G C G | | | T T G A G G C T A A CATTC G - C T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |