Sequence ID | >WENV180094974 |
Genome ID | MTBK01041777 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 168370 |
End posion on genome | 168296 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccagtgccac |
tRNA gene sequence |
GCCGCCTTAGCTCAGTCGGTAGAGCGATTCACTCGTAATGAATAGGTCAGGGGTTCGATT |
Downstream region at tRNA end position |
atctcttcta |
Secondary structure (Cloverleaf model) | >WENV180094974 Thr CGT c TCCg atctcttcta G - C C - G C - G G - C C - G C - G T - A T T T T C C C C A T G A A | | | | | G C C T C G A G G G G C G | | | | T T G G A G C T A G AGGTC A - T T - A T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |