Sequence ID | >WENV180094985 |
Genome ID | MTBK01042751 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 949 |
End posion on genome | 856 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cggtgcatct |
tRNA gene sequence |
GGAGAGGTGCCGGAGCCAGGTTGAACGGGACGTCCTGCTAAGACGTTGACCGCCGAAATG |
Downstream region at tRNA end position |
ttgccgtgtg |
Secondary structure (Cloverleaf model) | >WENV180094985 Ser GCT t GCCA ttgccgtgtg G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A C C G A G | | | | | A A G G C C G T G G G C G | | | T T G A C G G T T G A G TGACCGCCGAAATGCGGTCC A - T C - G G - C T - A C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |