Sequence ID | >WENV180094992 |
Genome ID | MTBK01042994 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 306 |
End posion on genome | 402 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tctttcacgc |
tRNA gene sequence |
GGGAGTAGATTGGTCCTGGTGGGCCTCCTGGACTTCAAATCCAGTGGCGGGCAGCTAACC |
Downstream region at tRNA end position |
ttttcatgcc |
Secondary structure (Cloverleaf model) | >WENV180094992 SeC TCA c GCCA ttttcatgcc G - C G - C G - C A - T G - C T - A A - T G G T T A C A C C C A T C C T | | | | | G G T G G T G T G G G C G + | | T T T G C C T G G C TGGCGGGCAGCTAACCTGGCCGCG C - G T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |