Sequence ID | >WENV180094997 |
Genome ID | MTBK01043128 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2314 |
End posion on genome | 2227 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acgggcaaca |
tRNA gene sequence |
GCCGGAGTGGCGAAAACGGCAAACGCGGAGGGCTTAAACCCCTCTGGGCGTAACACTCCA |
Downstream region at tRNA end position |
cttgtcacga |
Secondary structure (Cloverleaf model) | >WENV180094997 Leu TAA a ACCt cttgtcacga G - C C - G C - G G - C G - C A - T G - C C T T T G T C C A A A A G + | | | | G C A G C G G C A G G C G | | | T T G A C G C C A A G TGGGCGTAACACTCCAT G - C A - T G - C G - C G - C C C T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |