Sequence ID | >WENV180095024 |
Genome ID | MTBK01044081 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 31 |
End posion on genome | 115 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
acatttgagt |
tRNA gene sequence |
GTCGGGATGGCGGAACAGGCAGACGCGTACGTTTGAGGGGCGTATGGGTAATCCCGTGCG |
Downstream region at tRNA end position |
tctataaatt |
Secondary structure (Cloverleaf model) | >WENV180095024 Leu GAG t ACCA tctataaatt G - C T - A C - G G - C G - C G - C A - T T T T C G C C C A C A A G | | | | | G A G G C G G C G G G C G | | | T T G A C G C C A G G TGGGTAATCCCGT T - A A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |