Sequence ID | >WENV180095025 |
Genome ID | MTBK01044130 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 709 |
End posion on genome | 790 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcggccccca |
tRNA gene sequence |
GGGTCGGTACCCGAGTGGCCAAAGGGGGCAGTCTGTAAAACTGCTGCGCAAGCTACGCTG |
Downstream region at tRNA end position |
aaccagccgc |
Secondary structure (Cloverleaf model) | >WENV180095025 Tyr GTA a ACtc aaccagccgc G - C G - C G - C T + G C - G G - C G - C T A T C G A C C A T G A A | | | | | G G G C C C G C T G G C G | | | T T C A G G G C A A G TGCGCAAGCTAC G - C C - G A - T G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |