Sequence ID | >WENV180095036 |
Genome ID | MTBK01044776 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 499 |
End posion on genome | 584 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gagattacga |
tRNA gene sequence |
ACCCAGGTGGTGGAATTGGTAGACACGCTACTTTGAGGGGGTAGTGGGCATTCGCTCGTG |
Downstream region at tRNA end position |
tccctgcatc |
Secondary structure (Cloverleaf model) | >WENV180095036 Leu GAG a ACCt tccctgcatc A - T C - G C - G C - G A - T G - C G - C T C T T A C T C A T A A G + | | | | G T G G T G G T G A G C G | | | T T G A C A C T A G G TGGGCATTCGCTCGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |