Sequence ID | >WENV180095038 |
Genome ID | MTBK01044803 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 54 |
End posion on genome | 141 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcttcgagac |
tRNA gene sequence |
GCGAGGGTGTCGGAACCGGCAGACGAGCTGGACTTAGGATCCAGTGGGCAATACGCCTGT |
Downstream region at tRNA end position |
atgaaatcaa |
Secondary structure (Cloverleaf model) | >WENV180095038 Leu TAG c ACCA atgaaatcaa G - C C - G G - C A - T G - C G - C G - C T A T C C C C C A C A A G | | | | | A C G G C T G G G G G C G | | | T T G A C G A C A G G TGGGCAATACGCCTGT C - G T - A G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |