Sequence ID | >WENV180095041 |
Genome ID | MTBK01044958 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 166 |
End posion on genome | 81 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaagttatca |
tRNA gene sequence |
GCCGAAGTGGTGAAATTGGCAAACACGCAGCACTCAAAATGCTGTGGGATTTATTCCCTT |
Downstream region at tRNA end position |
tttttgttcc |
Secondary structure (Cloverleaf model) | >WENV180095041 Leu CAA a ACaa tttttgttcc G - C C - G C - G G - C A - T A - T G - C T G T C A C C C A T A A G | | | | | A T A G T G G T G G G C G | | | T T G A C A C C A A G TGGGATTTATTCCCTT C - G A - T G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |