Sequence ID | >WENV180095047 |
Genome ID | MTBK01045246 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 127 |
End posion on genome | 217 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agaaagttat |
tRNA gene sequence |
GGAGGGATACCCAAGAGGCTGAAGGGGGTAGTTTGCTAAACTGCTAGTGGGGGCAACTCC |
Downstream region at tRNA end position |
agtaacttag |
Secondary structure (Cloverleaf model) | >WENV180095047 Ser GCT t GCCA agtaacttag G - C G - C A - T G - C G - C G - C A - T T A T C T C T C A A G A A | | | | | G G A C C C G A G A G C G | | | T T C A G G G T G A G TAGTGGGGGCAACTCCAGC G - C T + G A - T G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |