Sequence ID | >WENV180095049 |
Genome ID | MTBK01045246 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1437 |
End posion on genome | 1510 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ctagccaatc |
tRNA gene sequence |
GCTTCTTTAGTTTAATGGTAAAACACCTCTCTCGTACAGAGTAGATGTTAGTTCGATTCT |
Downstream region at tRNA end position |
cgaagcgcgc |
Secondary structure (Cloverleaf model) | >WENV180095049 Thr CGT c TCCA cgaagcgcgc G - C C - G T - A T - A C - G T + G T - A T T T C A G T C A A A A | | + | | G T T T T G G T T A G C G | | | | T T G A A A C T A A AGAT C T C - G T - A C - G T - A C C T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |