Sequence ID | >WENV180095060 |
Genome ID | MTBK01046230 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 22614 |
End posion on genome | 22540 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tcttaagtga |
tRNA gene sequence |
GCGGGCGTAACTCAGTGGTAGAGTGCTACCTTGCCAAGGTAGACGTCGACGGTTCAAATC |
Downstream region at tRNA end position |
tttatttggc |
Secondary structure (Cloverleaf model) | >WENV180095060 Gly GCC a TCCA tttatttggc G - C C - G G - C G - C G - C C - G G - C T A T T T G C C A G A A + | | | | A T C T C A G A C G G C G | | | | T T G G A G T T A G ACGTC C - G T - A A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |