Sequence ID | >WENV180095061 |
Genome ID | MTBK01046230 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 22532 |
End posion on genome | 22457 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccatttattt |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGCTAAGGCAGCGGTCTGCAAAACCGTTATTCATGAGTTCGAAT |
Downstream region at tRNA end position |
ttgaagccga |
Secondary structure (Cloverleaf model) | >WENV180095061 Cys GCA t TCCA ttgaagccga G - C G - C C - G G - C G - C C - G A - T T A T T A C T C A T G A A | | | | | G G A C C G A T G A G C G | | | T T C A G G C T A A TATTC G + T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |