Sequence ID | >WENV180095094 |
Genome ID | MTBK01048554 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2119 |
End posion on genome | 2028 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttaattttaa |
tRNA gene sequence |
GCGTAAACGGCAACGATGGTGGTGTTGCACTTGACTGTAAATCAAGTCCCACAGGGTAAA |
Downstream region at tRNA end position |
attatttttg |
Secondary structure (Cloverleaf model) | >WENV180095094 Tyr GTA a ACCA attatttttg G - C C - G G - C T - A A - T A - T A - T T C C A T T C C A T A G C G | + | | | G G A A C G T G A G G C G | | | | T T T T T G C G G T G A TCCCACAGGGTAAACATT C - G T - A T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |