Sequence ID | >WENV180095101 |
Genome ID | MTBK01048801 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 569 |
End posion on genome | 656 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cttatttcca |
tRNA gene sequence |
GCCGGAGTGGTGGAACAGGTAGACACAAGGGACTTAAAATCCCTCGGGTGATAAGCCCGT |
Downstream region at tRNA end position |
tgcgggaata |
Secondary structure (Cloverleaf model) | >WENV180095101 Leu TAA a ACCA tgcgggaata G + T C - G C - G G + T G - C A - T G - C T G T C G G C C A C A A G | | | | | A A G G T G G C C G G C G | | | T T G A C A C T A G A CGGGTGATAAGCCCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |