Sequence ID | >WENV180095104 |
Genome ID | MTBK01049008 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1894 |
End posion on genome | 1810 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcttccccaa |
tRNA gene sequence |
GCGAGGGTTGCCGAGCCAGGTCAAAGGCGCAAGGTTGAGGGCCTTGTCATGAAGGTGTTC |
Downstream region at tRNA end position |
attatatcca |
Secondary structure (Cloverleaf model) | >WENV180095104 Leu GAG a Atct attatatcca G - C C - G G - C A - T G - C G - C G - C T A T C T C G C A C C G A T | | | | | A A G C C G G A G C G C G | | | T T G A G G C T C A A G TCATGAAGGTGTTC C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |