Sequence ID | >WENV180095105 |
Genome ID | MTBK01049166 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 325 |
End posion on genome | 410 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttaaatggtT |
tRNA gene sequence |
GCGGGGTTTGCCAAGCCGGCCAAAGGCGCAGGACTTAAGATCCTGTCTCGAAGGAGTTCA |
Downstream region at tRNA end position |
aacccatgct |
Secondary structure (Cloverleaf model) | >WENV180095105 Leu TAA T ATta aacccatgct G - C C - G G - C G - C G - C G - C T - A T A T T G C C C A C C G A T | | | | | G G A C C G A C G G G C G | | | T T C A G G C C A A G TCTCGAAGGAGTTC C - G A - T G - C G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |