Sequence ID | >WENV180095139 |
Genome ID | MTBK01051087 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 249 |
End posion on genome | 177 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
gcccacatat |
tRNA gene sequence |
CGCGGAGTGGAGCAGTGGCAGCTCGTTGGGCTCATAACCCAAAGGTCGCAGGTTCGAGTC |
Downstream region at tRNA end position |
gttcaaaaag |
Secondary structure (Cloverleaf model) | >WENV180095139 fMet CAT t ACaa gttcaaaaag C A G - C C - G G - C G - C A - T G - C T G T T G T C C A G A G + | | | | G T C G A G G C A G G C G | | | | T T G G C T C C A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |