Sequence ID | >WENV180095145 |
Genome ID | MTBK01051380 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 340 |
End posion on genome | 254 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gatgcaagta |
tRNA gene sequence |
GCGGAAGTGGCGGAATTGGTAGACGCGCAAGGTTGAGGGCCTTGTGGGAGCAATCCTGTA |
Downstream region at tRNA end position |
aaagtggaac |
Secondary structure (Cloverleaf model) | >WENV180095145 Leu GAG a ACCA aaagtggaac G - C C - G G - C G - C A - T A - T G - C T G T T T C C C A T A A G | | | | | A T G G C G A A G G G C G | | | T T G A C G C T A G G TGGGAGCAATCCTGT C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |