Sequence ID | >WENV180095150 |
Genome ID | MTBK01051667 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 390 |
End posion on genome | 305 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aaaaatacgt |
tRNA gene sequence |
GCGAGCGTGGCGGAAAGGCAGACGCGCCAGGTTCAGGACCTGGTGGGTGTATACCCGTGG |
Downstream region at tRNA end position |
ccaaaatttg |
Secondary structure (Cloverleaf model) | >WENV180095150 Leu CAG t ACCA ccaaaatttg G - C C - G G - C A - T G - C C - G G - C T C T T C T C C A A A A G + | | | | A G G G C G G G A G G C G | | | T T C A C G C A G G TGGGTGTATACCCGT C - G C - G A - T G - C G - C T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |