Sequence ID | >WENV180095162 |
Genome ID | MTBK01052335 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 284 |
End posion on genome | 194 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gatttttaga |
tRNA gene sequence |
GGAGAGATGGCCGAGCGGCTGAAGGCAGCTGCCTGCTAAGCAGTTGTACTGCCAAAAGCG |
Downstream region at tRNA end position |
gattttagat |
Secondary structure (Cloverleaf model) | >WENV180095162 Ser GCT a GCaa gattttagat G - C G - C A - T G - C A - T G - C A - T T A T G T C C C A C G A G | | | | | G G G C C G C A G G G C G | | | T T C A G G C T G A A TGTACTGCCAAAAGCGGTACC G + T C - G T - A G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |