Sequence ID | >WENV180095166 |
Genome ID | MTBK01052637 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 324 |
End posion on genome | 241 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgttcgccga |
tRNA gene sequence |
GCCCGGGTGGCGGAATGGCAGACGCGGCGGACTCAAAATCCGCTGTCCGAGAGGGCGTGT |
Downstream region at tRNA end position |
ttgtgatgga |
Secondary structure (Cloverleaf model) | >WENV180095166 Leu CAA a ACgc ttgtgatgga G - C C - G C - G C - G G - C G - C G - C T G T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T C A C G C A G G TGTCCGAGAGGGCGT G - C C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |