Sequence ID | >WENV180095170 |
Genome ID | MTBK01052958 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2004 |
End posion on genome | 2086 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcttgatcca |
tRNA gene sequence |
GGACGGTTACCCAAGTGGACAAAGGGGACTGACTGTAAATCAGTTGGCACAGGCCTTCGT |
Downstream region at tRNA end position |
ctggcagcac |
Secondary structure (Cloverleaf model) | >WENV180095170 Tyr GTA a Attt ctggcagcac G - C G - C A - T C - G G - C G - C T - A T A T C A A C C A T G A A | | | | | G G A C C C G T T G G C G | | | T T A A G G G C A A G TGGCACAGGCCTTC A - T C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |