Sequence ID | >WENV180095173 |
Genome ID | MTBK01053139 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 325 |
End posion on genome | 418 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttatatatag |
tRNA gene sequence |
GGAGAGGTGGCCGAGTTGGCTGAAGGCGCTCGCCTGCTAAGCGAGTAGACGGCTAATAAC |
Downstream region at tRNA end position |
tttaactaaa |
Secondary structure (Cloverleaf model) | >WENV180095173 Ser GCT g GCCA tttaactaaa G - C G - C A - T G - C A - T G - C G + T T A T C G C C C A T T G A G | | | | | A G G C C G G C G G G C G | | | T T C A G G C T G A G TAGACGGCTAATAACTGTCTC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |