Sequence ID | >WENV180095182 |
Genome ID | MTBK01053822 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 623 |
End posion on genome | 533 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgcccggcac |
tRNA gene sequence |
GGAGATGTACCGAAGTGGCCATAACGGGGCGCTCTCGAAAAGCGTTTGTCGGGTGACCGG |
Downstream region at tRNA end position |
aacacgaaac |
Secondary structure (Cloverleaf model) | >WENV180095182 Ser CGA c ACCA aacacgaaac G + T G + T A - T G - C A C T + G G - C T A T C T C C C A G T G A A | | | | | G G A G C C G A G G G C C | | | T T C A C G G A T A G TTGTCGGGTGACCGGCAC G + T C - G G - C C - G T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |