Sequence ID | >WENV180095191 |
Genome ID | MTBK01054892 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 189 |
End posion on genome | 273 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
caaatcacaa |
tRNA gene sequence |
GCCCACGTGGCGGAATTGGCAGACGCGCTAGTTTCAGGTACTAGTGACTAACATCGTACA |
Downstream region at tRNA end position |
ccttcattgt |
Secondary structure (Cloverleaf model) | >WENV180095191 Leu CAG a ACCA ccttcattgt G - C C - G C - G C - G A - T C - G G - C T G T T G T C C A T A A G | | | | | A T G G C G A C A G G C G | | | T T G A C G C C A G G TGACTAACATCGT C - G T - A A - T G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |