Sequence ID | >WENV180095193 |
Genome ID | MTBK01055021 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 48680 |
End posion on genome | 48754 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cggctcaaaa |
tRNA gene sequence |
GCGGGCGTAACTCAGTGGTAGAGTGTCAGCTTCCCAAGCTGAAAGTCGCGAGTTCGACCC |
Downstream region at tRNA end position |
agttcctact |
Secondary structure (Cloverleaf model) | >WENV180095193 Gly CCC a TCCA agttcctact G - C C - G G - C G - C G - C C - G G - C C C T T G C T C A G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A G AAGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |