Sequence ID | >WENV180095195 |
Genome ID | MTBK01055021 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 50846 |
End posion on genome | 50922 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
acaagcttat |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCCGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
atctttgatt |
Secondary structure (Cloverleaf model) | >WENV180095195 fMet CAT t ACCA atctttgatt C A G - C C - G G - C G - C G - C G - C T A T T G T C C A T G A G + | | | | A C C G A G G C A G G C C | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |